Background:  Plasma concentrations of efavirenz (EFV) and nevirapine (NVP) are subject to high inter-patient variability, probably due to effects of genetic polymorphism, leading to differences in the hepatic metabolism of these drugs. A single nucleotide polymorphism at position 516 (G to T) of the gene for CYP2B6 metabolizing enzyme has been reported to be associated with higher blood levels of EFV and NVP. The prevalence of this polymorphism is different in various ethnic groups. We provide preliminary data on the distribution of G516T polymorphism at the gene encoding CYP2B6 and its influence on EFV and NVP plasma concentrations in HIV-infected subjects in south India.

Methods:  HIV-infected subjects receiving EFV (600 mg once daily) or NVP (200 mg twice daily) along with 2 nucleoside analogs for a minimum period of 15 days at the Government Hospital of Thoracic Medicine, Tambaram, were included. Plasma samples collected at 12 hours for EFV and 2 hours for NVP after drug administration were analyzed for these drugs by high-performance liquid chromatography (HPLC). Genetic characterization of the CYP2B6 gene at position 516 was performed by polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis using genomic DNA extracted from whole blood. The primers, forward (5’ CTTGACCTGCTGCTTCTTCC 3’) and reverse (5’ TCCCTCTCCGTCTCCCTG 3’) were used to amplify a 204-base pair product. The PCR product was digested with BsrI at 65^oC overnight.  

Results:  A total of 130 HIV-infected subjects (EFV 64; NVP 66) were included in the study. The mean EFV concentrations at 12 hours in the GG, GT, and TT genotypes were 1.85, 2.00, and 6.44 µg/mL, respectively. The corresponding values for NVP at 2 hours were 7.60, 7.95, and 10.53 µg/mL. The plasma concentrations of EFV and NVP were significantly higher in TT genotypes than GG and GT genotypes (p <0.01). The TT genotype was seen in 40% of the subjects studied. The genotypes were confirmed by sequencing in 10 out of 12 DNA samples.

Conclusions:  Our preliminary data suggest that TT genotypes for the CYP2B6 G516T polymorphism constituted a higher proportion of the ethnic south Indian population, which is among the highest reported world-wide. This needs confirmation by sequencing the CYP2B6 gene for this polymorphism in a larger number of subjects. Higher plasma levels of EFV and NVP were observed in the TT genotypes. Immunogenetic characteristics leading to pharmacokinetic variations may influence treatment outcome and adverse events in different populations.